[Home] [Examples] [Contact]
The first RNA
Paste input below:
>PDB ID 1LNG UCGGCGGUGGGGGAGCAUCUCCUGUAGGGGAGAUGUAACCCCCUUUACCUGCCGAACCCCGCCAGGCCCGGAAGGGAGCAACGGUAGGCAGGACGUC ..((((..(((((.(((((((((....)))))))))..)))))....((((((((....((((.(((((....))))).)))).)))))))).))))
Format of the first RNA: CT formatBpseq formatDot-bracket format
The second RNA
>PDB ID 2B57 GACAUAUAAUCGCGUGGAUAUGGCACGCAAGUUUCUACCGGGCACCGUAAAUGUCCGAUUAUGUC ((((((.....(((((.......)))))..........((((((.......))))))..))))))
Format of the second RNA: CT formatBpseq formatDot-bracket format
Score matrix
>single-base scoring matrix: A C G U A +2.22 C -1.86 +1.16 G -1.46 -2.48 +1.03 U -1.39 -1.05 -1.74 +1.65 >base-pair scoring matrix: AA AC AG AU CA CC CG CU GA GC GG GU UA UC UG UU AA -2.49 AC -7.04 -2.11 AG -8.24 -8.89 -0.80 AU -4.32 -2.04 -5.13 +4.49 CA -8.84 -9.37 -10.41 -5.56 -5.13 CC -14.37 -9.08 -14.53 -6.71 -10.45 -3.59 CG -4.68 -5.86 -4.57 1.67 -3.57 -5.71 5.36 CU -12.64 -10.45 -10.14 -5.17 -8.49 -5.77 -4.96 -2.28 GA -6.86 -9.73 -8.61 -5.33 -7.98 -12.43 -6.00 -7.71 -1.05 GC -5.03 -3.81 -5.77 2.70 -5.95 -3.70 2.11 -5.84 -4.88 5.62 GG -8.39 -11.05 -5.38 -5.61 -11.36 -12.58 -4.66 -13.69 -8.67 -4.13 -1.98 GU -5.84 -4.72 -6.60 0.59 -7.93 -7.88 -0.27 -5.61 -6.10 1.21 -5.77 3.47 UA -4.01 -5.33 -5.43 1.61 -2.42 -6.88 2.75 -4.72 -5.85 1.60 -5.75 -0.57 4.97 UC -11.32 -8.67 -8.87 -4.81 -7.08 -7.40 -4.91 -3.83 -6.63 -4.49 -12.01 -5.30 -2.98 -3.21 UG -6.16 -6.93 -5.94 -0.51 -5.63 -8.41 1.32 -7.36 -7.55 -0.08 -4.27 -2.09 1.14 -4.76 3.36 UU -9.05 -7.83 -11.07 -2.98 -8.39 -5.41 -3.67 -5.21 -11.54 -3.90 -10.79 -4.45 -3.39 -5.97 -4.28 -0.02
Gap penalty -1 -2 (default: -1)